Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_312D04-3
Clone ID CMHD-GT_312D04-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_312D04-3
Sequence
CTCAAAGTCCTTATCTTCCCCACTATGGAGGAGTAGATGTCCACTTCTCAGGAGCAGCTGACTGCTTCCGGCAGATCGTG
AAAACCCAAGGGGTACTGGGGCTCTGGAACGGACTGACGGCTAACTTACTAAAGGTAGTTCCGTATTTTGGAGTTATGTT
TAGCATGTTTGACTTCTGTAAGAGAATTTTTCTTTATCAAAATGGTTACACCCTGTCCCCACTGACCTATAAACTGACCC
CACGAGTGGACCAAACTTTGAACCCCCAGGAATTACAGGACCTAAATAAGTTCTTCAAACGCAGAAAACTGCACTCCTAA
ACACCACCTTGGTAAATAAAGCTGACTAGAAC
Sequence Type mRNA
Unitrap ID UNI13451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34315478..34317214 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037636 (Slc25a43) NM_001085497 solute carrier family 25, member 43 Gene [Source:MGI (curated);Acc:Slc25a43-001]

 
Come back to gene ENSMUSG00000037636


For any suggestions or comments, please send an email to unitrap@crg.es