Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12332B4
Clone ID IST12332B4
Vector VICTR76
Project tigm

Sequence tag IST12332B4BBF1
Sequence
AGGCCTTCTCAGCCTGTCCCCAAAGAAACCTTTCACCCACCTGCCATCAATAGATGGCCTCTGTAGCCACCCAAGCGACA
AGCAACTGATCCCATGCAGTTTCTCCTCACCGCCTATATGCCTGCTCTGCCGGTTTCATAGGGACAGGCCCTTAGTTGGA
CTTGATGGCTCAGACCTCTAACTCAGGAGGCTGAGGCAGTAGAATTGTAGGTTCAAAGCTAGCAAGATTTTGGGGGAGGG
ATGAGGGGACCCTGCCTCCTGGCCTGTGTGTTCTATCCAGACACTGGGTAGAACTTCAAAGAATGGTAGTTTTGCTTGGT
TTTCTTCTCAGCACTAGGTATGGAACCCCAGGCTTGACATACCACGCTGAACAAGTGTCCAGTTACAAAGCCACACTTCT
AGCTCTTAATGAAACCCATGTCCTGGANGCTGGCATGATCTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102139558..102140009 450
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034768 (Asb16) NM_148953 ankyrin repeat and SOCS box-containing 16 Gene [Source:MGI (curated);Acc:Asb16-001]


Sequence tag IST12332B4HMF1
Sequence
AGGCCTTCTCAGCCTGTCCCCAAAGAAACCTTTCACCCACCTGCCATCAATAGATGA
Sequence Type genomic DNA
Unitrap ID UNI14010

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102139558..102139613 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034768 (Asb16) NM_148953 ankyrin repeat and SOCS box-containing 16 Gene [Source:MGI (curated);Acc:Asb16-001]

 
Come back to gene ENSMUSG00000034768


For any suggestions or comments, please send an email to unitrap@crg.es