Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14158D10
Clone ID IST14158D10
Vector VICTR74
Project tigm

Sequence tag IST14158D10HMR1
Sequence
TTGTCNGAGCAACCCATATATGTACACACATCTTCATAAAGGTCCTCCTTAAGAGCTCGAGTCTCAAGGTCTAGGGCCTG
ATGTCACATTCTGCGCTGTGTTAGGTTCTTTGTGTCCACCGACAACACTTGGCCTCCGACTTTCACAAGTTTGTTTGTTT
GGGTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127386186..127386361 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14158D10BBF1
Sequence
CAGGGATGGATCTGAGGCAGGCTTTTTGGAAGCAGCTTTGCACCCTAACCCATCTTGTGTGTGGCCTTTATTTCCTTTAG
GGAGAGCCCTAAGGGTCCTAGGGAGTGAGTGGTGCAGCCCCACCCTGAGCAGTCCCTCACCGATGGACTACTAGGGTTTT
AATTCCTCTGGGACACAATGTGATGGGCACTGCGAATTGGCCCACCTCCTTTGTAACTGCTGACTGCGATGAAACCCAAT
TGAACAGCCTGAACTCTAGGATGAATTTCTAGCCGTGACCCTTCCACTCACCCTTCTGAGTGACAGGACACTCCTGGCAA
CTTTTCCACCAGAAAATAGCCNTCCNGGGGATTGCTGTGCCCACAAAGTACTTCCCTTNAAAGTCTCAGGANGGCAGANC
TCTGGGCTCANGGTGGANCCCAGTCTGTACAGCGCTTGCCCNGTATGTCTGGCTTGNCTAGTTACNCAGAAACTGGGCTT
GGTGGGACATGCCCNNTGATTTNNNCTCCNGGGANTNNNCGNCNNNANGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86446790..86447303 482
 
EST/CDNA Est Name
  CK379018.1 - CF356043.1 - BE534533.1

 
Come back to gene CK379018.1 - CF356043.1 - BE534533.1


For any suggestions or comments, please send an email to unitrap@crg.es