Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12780C7
Clone ID IST12780C7
Vector VICTR76
Project tigm

Sequence tag IST12780C7HMF1
Sequence
NGATAACCAGCGGGGAGTTATATTAGAGCAGTTTCTATGTTTTGAGGCATGTTTTTAGGGTATTTCAATATTAACTACTT
CTTAGCCCATTAGCCAGTGACTGTGTGACATAAGTCATGTGGCCTCTGTGCACTTCTGTCATATAAATTTTTCTGATAAG
TTGGTTATTTAAAAATTCCTCTGGGCCACTAAACAACTCATGGTTTAATAGTGGAAAAAACTGACCGCTAAAAGTGAATC
ACAAAATCTCCCAGAATATACATTTTAAATAAGTGCAATATACAAACTTGAAAACATACCCCTTTGGATAAAGAGTTTAG
GCAGCAGAGAGAAAGGCAGTATCCAGCCCCAGTTTAATATATTTTCTTTCCCTCTCACCATTTAGCTGTTCCACTCNTTG
CNNAGTTGGCCTGAGANGGGTGTGCACAGGTAATCCCGGAAGGGACTAANTTNNNTTCATTCTTTTGCTTTGAGCN
Sequence Type genomic DNA
Unitrap ID UNI2783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 90921951..90922424 458
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035246 (Pcyt1b) NM_211138 phosphate cytidylyltransferase 1, choline, beta isoform Gene [Source:MGI (curated);Acc:Pcyt1b-003]

 
Come back to gene ENSMUSG00000035246


For any suggestions or comments, please send an email to unitrap@crg.es