Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11845D3
Clone ID IST11845D3
Vector VICTR76
Project tigm

Sequence tag IST11845D3HMF1
Sequence
ATTCTGTACTGTTCATTGAATGTCAGGCATTTTTTCTCGGAGCTATACATTTGTTGTTGTTGTTCAAGCCTTCACATGGC
TACTCTTGTTCTCTGTCCGCATTTACAGAGAGTTAAACTGACCCGGGAAGAGCACCTACGCCTCGCCCTGTTGTTCACTA
TCTGTGTACTGTAGAATCTGGGCATGAAGGCAGGCTGCTGGGGGCTGGGCTCTGCTCAGCTGCCCCACACAGGCCTCCTG
GGAAAGGACTTCTCAGTCTCTTTATTAACGTGGGCATCTATTTCTAAACATACTATAGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI30157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135208914..135209218 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST11845D3BBF1
Sequence
ATTCTGTACTGTTCATTGAATGTCANGCATTTTTTCTCGGAGCTATACATTTGTTGTTGTTGTTCAAGCCTTCACATGGC
TACTCTTGTTCTCTGTCCGCATTTACAGAGAGTTAAACTGACCCGGGAAGAGCACCTACNCCTCGCCCTGTTGTTCACTA
TCTGTGTACTGTAGAATCTGGGCATGAAGGCAGGCTGCTGGGGGCTGGGCTCTGCTCANCTGCCCCACACAGGCCTCCTG
GGAAAGGACTTCTCANTCTCTTTATTAACGTGGGCATCTATTTCTAAACATACTATANAGTNAACANTCTANTGTATTCC
TTATTACTAANTGCCTGGCNANATGANANNGTCNTCGGAATGANGGAANACCCACAGANCTTCCTTCCCCCCCCCNNCNT
TNTTTCCTTTTCCGGANNCTAAGGNNNNNCNNGGANAGGGGTTCCNACCNANGGNGTNACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es