Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10062F7
Clone ID IST10062F7
Vector VICTR75
Project tigm

Sequence tag IST10062F7HMR1
Sequence
NATTGCCTAAGAACCTTCATTCTGTCGTGTAGTTTTATAAATCTAGGGGATGGCCGGCCATGGTGGCACACACCTTTAAT
CCCAGTACTCGAGAGGCAGAGGCAGGTGGGTCTCTGAGTTTGAGGAGAGCCTGGACTACAGAATCGAATCCAGAACAGCC
AGGGCTCCACAGAGAAAAACCCTGTTTCAGAAAAAAAATAAATAAAAAGAAAAAAAAATCCANNANAAGGGTGAAGTTAC
TGCCAGGCANANATAGAGCATCTTGGGCTGGCCTTGGGATTCTTTTGTGANAGGTCTGCTTATGTTTCTGN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857872..97858180 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


Sequence tag IST10062F7BBF1
Sequence
ATATGAAAAAGTAGAGCAGGAAAAGGATCTGTCGAGGTCGATCGCCGGTTTCAATGACCCCAATTTATCTGAGAAGGAGC
CTCTATCTTCCCTTAAAGACTCTGAGTTTGAATACACTAACCTCAGGGTTTTTTAAATGCAAACTTTAACTTCCCTTACA
TCTAGCTGCCTTCTTTCTAGTGCCCTTTAGCTTCATAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 23212711..23212848 136
NO GENE  

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es