Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11548E8
Clone ID IST11548E8
Vector VICTR76
Project tigm

Sequence tag IST11548E8HMF1
Sequence
NCGTGAGCACCCTTTAAGTGAGGGAANACCTGGGAAGGTGGCTTCTCTGAGAACTGCAGCANAGTGAGTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11548E8HMR1
Sequence
AAATAGNNANATNACTTTCTGAAACAAAATTACTTTATTAGTTTAGTAATAATTTGAGGTTACTTTAAAGATAAGAAGCA
GCATTTGGGAGGAGATTCATTTCCTGCCTCCCAGCCTTATCTGCAAGAACTACATCTTTAGTGTCAAGAGACTGTGTGTT
TATAACAGAACTCTAATAAAGTCTGTCCTGGGCATACTGCACACCTGACTTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI1043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76877007..76877222 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es