Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_252B01-3
Clone ID CMHD-GT_252B01-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_252B01-3
Sequence
TGCAGGAGCAGAAGAATCCAGATTCGGAACATCCCGCCTCACCTGCAGTGGGAGGTGTTGGATGGGCTGTTGGCTGAATA
TGGGACAGTGGAGAACGTGGAGCAAGTCAACACAGATACAAAAACTGACCGTTGTCAACGTCGCCTATATGACAAAACAA
TAAGCAAAACTAGCTGTTGAGAAGCTCAGTGGGCATCAGTTTGAAGACTACTCCTTCAAGATTTCCTACATCCCCAATGA
ACAGGTGAGCTCTCCTTCTCCCCCTCATCGAGCCCGGAAACAAGGCCGCAGGCCCGGGAGCTCTTCTCAGGCCAGACTGA
TTGATTTCCCGCTGCGGATCCTGGTCCCCACCCAGTTTGTTGGTGCCATCATCCGAAAGGATGGCTTGACCATAAAGAAC
ATCAC
Sequence Type mRNA
Unitrap ID UNI13456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22081825..22089186 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es