Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13045B10
Clone ID IST13045B10
Vector VICTR76
Project tigm

Sequence tag IST13045B10HMR1
Sequence
TGTGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGAT
Sequence Type genomic DNA
Unitrap ID UNI33633 UNI33634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4345968..4346013 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054611 (Fbxl11) NM_001001984 F-box and leucine-rich repeat protein 11 Gene [Source:MGI Symbol;Acc:MGI:1354736]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62860377..62860422 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26048539..26048584 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108333582..108333627 46
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 86467941..86467986 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028080 (Lrba) NM_030695 LPS-responsive beige-like anchor Gene [Source:MGI Symbol;Acc:MGI:1933162]

 
Come back to gene ENSMUSG00000028080


For any suggestions or comments, please send an email to unitrap@crg.es