Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14270F5
Clone ID IST14270F5
Vector VICTR74
Project tigm

Sequence tag IST14270F5HMR1
Sequence
NNCNGTCTTCAGACACTCCANAAGANGGAGTCAGATCTCCTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTT
GAACTCCAGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCANCCCATTGTTGTTGTTTATTAT
TAAATTATTTTACGTGTGTGGATGTCCGTGTCTGANTCTGTGGANGGCATTGNATCTCATGGAACTTAANTCNCAGATGG
NNGTGAACCATCANGTGGGGGCTGAATCCNGANCACNTNNANNTGCNTTGACCTNNGGATCCNTCCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14270F5BBF1
Sequence
ACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI28087 UNI29896 UNI30969 UNI30970

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18233..18275 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166458: 3886..3928 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 152112..152154 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161875: 123716..123758 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 317984..318026 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3064037..3064079 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3104609..3104651 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6384770..6384812 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3014557..3014599 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4420126..4420168 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3635722..3635764 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033781 (Asb1) NM_080857 ankyrin repeat and SOCS box-containing 1 Gene [Source:MGI (curated);Acc:Asb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3449335..3449377 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3282325..3282367 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020451 (Limk2) NM_001034030 LIM motif-containing protein kinase 2 Gene [Source:MGI (curated);Acc:Limk2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 5858069..5858111 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 6197502..6197544 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072742 (AC157601.7-201) Alpha27-takusan [Source:UniProtKB/TrEMBL;Acc:A6NAU4]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 3277501..3277543 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020539..3020581 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4965617..4965659 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024120..3024162 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3147176..3147218 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211819..3211861 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9213255..9213297 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 5755511..5755553 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3237247..3237289 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026643 (Nmt2) NM_008708 N-myristoyltransferase 2 Gene [Source:MGI (curated);Acc:Nmt2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4570778..4570820 43
NO GENE  

 
Come back to gene ENSMUSG00000026643


For any suggestions or comments, please send an email to unitrap@crg.es