Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14980F10
Clone ID IST14980F10
Vector VICTR76
Project tigm

Sequence tag IST14980F10HMR1
Sequence
GCTTTGAGTACCAACACAGATTTGCCNGAATTCAACATTAGCTTTC
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39080953..39080997 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]


Sequence tag IST14980F10BBF1
Sequence
AAAGCAATTCATTTGACTGTAATCAACTCAGTCATGAGATTAAACAAAATAAATATTAAGATACCAGAGATACATTTGAA
CCTGGTCTGCCACTTAAATAATAGATCATATTTCTATACAAATATTCTGATATTTTCTAGTTAGAATGTAGGTAAAGGTA
AGGGTTTTCTAACAGCACAGCCCATTACTAAGTAATGTAAAAATAATTAAGGATAGTTGATAGGCAGCAAACAAGCAAGA
AGAAAGCACTTATACTACCATCTACCAACCCACATACTGTTCCTGCNAACCTAATCTCTACTGCAGCTGGTTCATCCATT
TTCTTGGTCANNNANCNNTTTTCAATTCTGTGCATTTTACTCNNAAATAGACTGAGTACTGTGANNNNNNTNGTCACACA
GAANGCNAGTGACTTANGAAAAAATATTGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14980F10HMF1
Sequence
AAAGCAATTCATTTGACTGTAATCAACTCAGTCATGAGATTAAACAAAATAAATATTAAGATACCAGAGATACATTTGAA
CCTGGTCTGCCACTTAAATAATAGATCATATTTCTATACAAATATTCTGATATTTTCTAGTTAGAATGTAGGTAAAGGTA
AGGGTTTTCTAACAGCACAGCCCATTACTAAGTAATGTAAAAATAATTAAGGATAGTTGATAGGCAGCAAACAAGCAAGA
AGAAAGCACTTATACTACCATCTACCAACCCACATACTGTTCCTGCTAACCTAATCTCTACTGCAGCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39080651..39080957 307
NO GENE  

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es