Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_312H11-3
Clone ID CMHD-GT_312H11-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_312H11-3
Sequence
CTGCCTTCTGCAGTTACCTGTGCCAGATTTGGGGCACAGAAGCCACCAATCCCTTCCTTATTCTCTGGGCAACATGGGCC
ACCTCCCTATGGGGACAACAGGGGACTCTCACCTTCTTATCTTGGTGGGCCCCGAGGAGGAGCACCAGCCCAATTTGAAG
ACCGCAAGGATCCTCATGGGGAGAAAAGGGAATTCCAGGACACTCCGTACAACGAGATGACAGGTGCCCCTGCTCAGTGT
GAAGGGCCAGATCAGGCCCAGTTCATGGGGAACAGGGCACCCTTTCAGTTTGGAGGCCAGAGACGGCCACTGCTAACTCA
AATGAAAGGGCCCCGTGGAGGACCTCCACCCTCTCAGTTTGGAGCCCAAAGGGGACCACCTCCTGGTCATTTCGTGGGCC
CACGTGGGCCCCATCCTAGTCAGTTTGAAAATTCCCGGGGCACCTCACCCTGGCCAGTTTGAAGGGGCCAGGGGCCAAGC
ACCTGGTTTCATGCCAGGCCCCCGGGGTATTCACCCCCAGCAGTT
Sequence Type mRNA
Unitrap ID UNI12280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180394882..180395385 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es