Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14560H3
Clone ID IST14560H3
Vector VICTR74
Project tigm

Sequence tag IST14560H3HMR1
Sequence
NGGGGATGTACTCATTANTAAGGGACAGCCTAGCCATGGTGCTTGAAGCTGCTTTGGTTTGGTGACACCCCCCCCCCNAT
Sequence Type genomic DNA
Unitrap ID UNI4185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589357..168589432 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027547 (Sall4) NM_201396 sal-like 4 (Drosophila) Gene [Source:MGI (curated);Acc:Sall4-002]


Sequence tag IST14560H3HMF1
Sequence
CCCCTTGCTCTAGAACCAACAACAAACACCCCATGGATTCAAGAAGGCTAAAGTCAAGTGGGAGGGGAACCACTGGGCGA
CCCTTGCCACCCGGGAGCCTTTATTCAAGGGAGCGAAATACCAAAACTACTTCAGGTTGTGAGAATTAACGGTGAGGTCC
TTCGAGGTCCCAGGCTGGAGCCTGCCACATAGCAGGTTCCAGTGAAAACTGTCATTCCGTGGATGAAATTACCTCAACAT
GCAAGGAGTCTATAGAAAACTTTTTCACTGCCACTGTACACAAGGACCCAAAAAGCTGGGTGAATAAGTGGGGGTACACT
AGTCCACCTAGGCAAGGTTACACCCAGAATGCAACGCCGAGCTTCCTCGTACTGAATCCTGCCNAAATTCTTTTCCCCAA
ATTCTCATTTGACATTTTACATCCAAAANGANGAGATTCAAAAATAACCNTGCCTCANCTCCCCCAAAACGGCTCCCGGT
CCCCTACTTAAACTGAAATCCCCTTAATCCCCATCACCAATGACAAANTATCGTTNACTGGCNGTGGANAACCNCCNAGG
GTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589430..168589991 540
 
EST/CDNA Est Name
  BB694983.1 - CF534510.1 - BY729264.1 - CN691766.1 - CF899104.1 - CF174904.1 - CN703522.1 - CD541530.1 - CF914407.1 - CD543181.1 - BB651753.1 - CF162417.1 - CF915439.1 - CN686788.1 - CN682519.1 - CN671806.1 - CN686133.1 - CD545404.1 - CD541943.1 - CD541671


Sequence tag IST14560H3BBF1
Sequence
CCCCTTGCTCTAGAACCAACAACAAACACCCCATGGATTCAAGAAGGCTAAAGTCAAGTGGGAGGGGAACCACTGGGCGA
CCCTTGCCACCCGGGAGCCTTTATTCAAGGGAGCGAAATACCAAAACTACTTCAGGTTGTGAGAATTAACGGTGAGGTCC
TTCGAGGTCCCAGGCTGGAGCCTGCCACATAGCAGGTTCCAGTGAAAACTGTCATTCCGTGGATGAAATTACCTCAACAT
GCAAGGAGTCTATAGAAAACTTTTTCACTGCCACTGTACACAAGGACCCAAAAAGCTGGGTGAATAAGTGGGGGTACACT
ANTCCACCTAGGCAAGGTTACACCCAGAATGCAACGCCGAGCTTCCTCGTACTGAATCCTGCCAAAATTCTTTTCCCCAA
ATTCTCATTTGACATTTTACATCCNAAAGGANGANATTCAAAAATAACCATGCCTCAGCTCCCCCAAAACGGCTCCCGGT
CCCCTACTTAAACTGAAATCCCCTTAATCCCCATCACCAATGACAAANTATCGTTTACTGGCNNNGGNNNAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168589430..168589971 532
 
EST/CDNA Est Name
  BB694983.1 - CF534510.1 - BY729264.1 - CN691766.1 - CF899104.1 - CF174904.1 - CN703522.1 - CD541530.1 - CF914407.1 - CD543181.1 - BB651753.1 - CF162417.1 - CF915439.1 - CN686788.1 - CN682519.1 - CN671806.1 - CN686133.1 - CD545404.1 - CD541943.1 - CD541671

 
Come back to gene BB694983.1 - CF534510.1 - BY729264.1 - CN691766.1 - CF899104.1 - CF174904.1 - CN703522.1 - CD541530.1 - CF914407.1 - CD543181.1 - BB651753.1 - CF162417.1 - CF915439.1 - CN686788.1 - CN682519.1 - CN671806.1 - CN686133.1 - CD545404.1 - CD541943.1 - CD541671


For any suggestions or comments, please send an email to unitrap@crg.es