Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14699E9
Clone ID IST14699E9
Vector VICTR76
Project tigm

Sequence tag IST14699E9BBF1
Sequence
GTCCCACCCAAGANTCTCCATGCCATTTCTACCTGGAGAGTCATCTGCTTTGAGAGAGAGAGAGAGAGCTGGAGGCACCA
GAGCTTTCTTCTTCCAGGAAGTCCCTTCCCCCACCCCACCCCACCCAGCCCCACCCGCTACTCACGCCCCTATATAATAT
TCCACGTTAGAGCTCATAAATGCTACTGCGGGTCCCCANCCTGATTGAATTTGGAAGCCATTGTTTACAGACGTCTGGCT
GTACAGGGGGATTTANTGAATTTTCCATGANATGTTGCTCCCCTAATGCTGTAAAANGCNAGCANCCCACATCAGANNAN
CCCTGCGCTANNNGANCATGTTACCTCGANANGNAGTGCCTGCCTCACGGTGTCCATGCACCAANCTCTAGCTCNGGGCA
GACACAGAGNCCTACAGTGTCACACCTTCTGANCCNACCTCTTGCTCTCCTTTCCCCTNTGCTNANTTCCAGTCANTCAN
AAAGTNCATCCCNCCTGCNANNGCCNNNCNGCTGCNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14699E9HMF1
Sequence
GTCCCACCCAAGAGTCTCCATGCCATTTCTACCTGGAGAGTCATCTGCTTTGAGAGAGAGAGAGAGAGCTGGAGGCACCA
GAGCTTTCTTCTTCCAGGAAGTCCCTTCCCCCACCCCACCCCACCCAGCCCCACCCGCTACTCACGCCCCTATATAATAT
TCCACGA
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117043390..117043555 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14699E9HMR1
Sequence
GGACCTGAGGGCCNCCAAACTAGGGTTGAGAAGGAGGGCAGCGATTTGGCCTTTTGGCAATGGCTGTGGGGGAAATGTGG
TCGGAGTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117043552..117043642 89
NO GENE  

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es