Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14550A9
Clone ID IST14550A9
Vector VICTR74
Project tigm

Sequence tag IST14550A9HMR1
Sequence
TATATGCTATAAGTATAGATCGATACAGATAATATTGTAGTGTAGAGTTGCTTTAGAGAATTTAGTTTGTTTTGAGGATA
AAAACC
Sequence Type genomic DNA
Unitrap ID UNI12063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51744774..51744859 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062248 (Cks2) NM_025415 CDC28 protein kinase regulatory subunit 2 Gene [Source:MGI (curated);Acc:Cks2-001]


Sequence tag IST14550A9HMF1
Sequence
ATACTTCTGGCTTTTGATGGTTTATGTTAAAGTATTAGGCCAATATAAGTTGCACAAAAATGAAAGGCATTTTATTCTGT
AGGGGTAAATTTCTAGCAGAATACTTGTTATTGAGCTATCTTCTAGGAATAGGACCTTAAAATCTAAAAAGTCATGAAGC
AACTCTTGGTCTATAGGATATAGGTAGAAAATATTCATGTACTGGAAAGTATACTCAAAGAGCAAGACCATACCCAAGTA
AAAAAATATTCTCTCCTGTTAAATAGACTGGTGGTATTAGGATAGCTAGAACAGCAAGAGAAAGTCAGAGGCAGTCTAAA
AGGGAGTTATATGTAACTTATATGTAAGAGTAAGGAGCCTAGTCCCAGAATTAGTTGTCACCTCANCCTGAGATTACTAA
ACTTTTAGTACTGGGGCTTGGANGGGGGGGAACCAAACTAAGTTAATGTGTTCCCTGTTATTCAANACTAAATCTGTAGT
ACTTGTATATATTCNNGTTTGCTTCANGCTCCAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 51744262..51744776 503
 
EST/CDNA Est Name
  BI105751.1 - AW244688.1 - CF584768.1 - CK345487.1 - CR517303.1 - BG070527.2 - AI875474.1

 
Come back to gene BI105751.1 - AW244688.1 - CF584768.1 - CK345487.1 - CR517303.1 - BG070527.2 - AI875474.1


For any suggestions or comments, please send an email to unitrap@crg.es