Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11596G10
Clone ID IST11596G10
Vector VICTR76
Project tigm

Sequence tag IST11596G10HMF1
Sequence
CCTTTAAGATACTATAAAGCATTTATTAAACTCTTTGACATTAAAATATTAGATTTTGAAAATAAAGGTAAGACTTTAAT
AGTGTGCATGGGAATGCACTAAATAGCATGCNCGGGGATACAATTTCTCTCTTTTTTGTCTTTTAAGAAGTTAAAGTTTT
AAAATTTTACAATACCTAAACTTTTGAATTAATAACTAGTTA
Sequence Type genomic DNA
Unitrap ID UNI11971 UNI15587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 90995717..90995917 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036206 (Sh3bp4) NM_133816 SH3-domain binding protein 4 Gene [Source:MGI (curated);Acc:Sh3bp4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873136..9873336 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 69662034..69662234 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8763455..8763655 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112767717..112767917 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55705996..55706196 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35315473..35315673 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88593853..88594053 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520272..88520472 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 143433957..143434157 199
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140780..27140980 199
NO GENE  


Sequence tag IST11596G10HMR1
Sequence
ANGGATCTACTTATTGGCTTATAGATTAATCCTAAAACAGCTACCTTATTAGAAAAGGGAAAAACAGGTTTTCTCCNCAG
AACGCTGCANAAGCATATTAGTAAATTCGTGTGACGAGCTGGTAGGTAAGTTC
Sequence Type genomic DNA
Unitrap ID UNI14719

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 136299684..136299813 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30018962..30019091 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873007..9873136 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52079397..52079526 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114511794..114511923 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14234423..14234552 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 88104704..88104833 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 125736069..125736198 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88593724..88593853 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88520143..88520272 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033182 (Klhdc6) NM_029013 kelch domain containing 6 Gene [Source:MGI (curated);Acc:Klhdc6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 61143271..61143400 126
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140651..27140780 126
NO GENE  

 
Come back to gene ENSMUSG00000033182


For any suggestions or comments, please send an email to unitrap@crg.es