Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14720C4
Clone ID IST14720C4
Vector VICTR76
Project tigm

Sequence tag IST14720C4HMF1
Sequence
AGACTCTGGCAAGTTTAGTAAGAATATTAGATAGTTCACCAGGATAAAGTAGTAGTAATTTCTAAGAGAGTTGTTTAAAA
AAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13110126..13110215 90
NO GENE  


Sequence tag IST14720C4BBF1
Sequence
AGACTCTGGCAAGTTTAGTAAGAATATTAGATAGTTCACCAGGATAAAGTAGTAGTAATTTCTAAGAGAGTTGTTTAAAA
AAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13110126..13110215 90
NO GENE  


Sequence tag IST14720C4HMR1
Sequence
TNAAAGGGTTTTTTCCCCCCTAGTGTAGTAGTAAGGAATGAACTTAAGATTGCTTATAATTTGAGGCATTAAAATCTTTG
CAATCGGTGATATACCAATACTAAATAGAAAAAAGAATANTTC
Sequence Type genomic DNA
Unitrap ID UNI10798

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13110235..13110354 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068039 (Tcp1) NM_013686 t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

 
Come back to gene ENSMUSG00000068039


For any suggestions or comments, please send an email to unitrap@crg.es