Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_286G08-3
Clone ID CMHD-GT_286G08-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_286G08-3
Sequence
AGGGTCCAGCATCCGCACGAGTGTCCTTCCTGTGGAGGCTTTGGCTTCCTTCCATGCTCTGTGTGCCACGGAAGCAAGAT
GTCAGTGTTTCGCAATTGCTTTACGGACGCTTTCAAAGCCCTCAAGTGTACAGCTTGCAATGAGAATGGTCTCCAGCGTT
GTAAGAACTGCACCTGCTAACTGGAGCTTCTGCCTAGAGAAAGCCTCATTTCATTAAACAAAGGATAAAATTTGACTTCT
AAGC
Sequence Type mRNA
Unitrap ID UNI13474

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 68557331..68557574 244
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068082 (AY616753) NM_001018019 glutaredoxin, cysteine rich 1 Gene [Source:MGI Symbol;Acc:MGI:3577767]

 
Come back to gene ENSMUSG00000068082


For any suggestions or comments, please send an email to unitrap@crg.es