Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11572E3
Clone ID IST11572E3
Vector VICTR76
Project tigm

Sequence tag IST11572E3BBF1
Sequence
ACTGCTCTCCGAAGGTCTGAAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCATGTGTAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1859 UNI31247 UNI32020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98514457..98514530 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017211 (Gsdma2) NM_029727 gasdermin A2 Gene [Source:MGI (curated);Acc:Gsdma2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121262329..121262402 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027248 (Pdia3) NM_007952 protein disulfide isomerase associated 3 Gene [Source:MGI (curated);Acc:Pdia3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134854773..134854846 70
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 135843494..135843567 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048170 (1110007A13Rik) NM_145955 RIKEN cDNA 1110007A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920977]


Sequence tag IST11572E3HMR1
Sequence
NNTCNGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCGTAT
Sequence Type genomic DNA
Unitrap ID UNI34098 UNI34099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 52112098..52112138 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038624 (Nepn) NM_025684 nephrocan Gene [Source:MGI Symbol;Acc:MGI:1913900]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44573388..44573428 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 45762947..45762987 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 170050366..170050406 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59583616..59583656 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 103879574..103879614 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034573 (Ptpn13) NM_011204 protein tyrosine phosphatase, non-receptor type 13 Gene [Source:MGI Symbol;Acc:MGI:103293]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 91375841..91375881 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148566166..148566206 39
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 62650110..62650150 39
NO GENE  

 
Come back to gene ENSMUSG00000034573


For any suggestions or comments, please send an email to unitrap@crg.es