Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0153
Clone ID AY0153
Vector pGT0lxr
Project sanger

Sequence tag AY0153
Sequence
GGCACTGTCCGCCAGCCGGTGGATGTGCGGCAACAACATGTCCGCTCCGATGCCCGCCGTTGTGCCGGCCGCCCGGAAGG
CCACCGCCGCGGTTATTTTCCTTCACGGATTGGGAGATACAGG
Sequence Type mRNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4797974..4798567 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es