Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14958G5
Clone ID IST14958G5
Vector VICTR76
Project tigm

Sequence tag IST14958G5BBF1
Sequence
ATGGTCAGTCCAGTCCTGTTAAAATATGGGAGTGAAGAGCTGGCTTAGAGATTCAGAACACTTGTTACTCTTGCCAAGGA
CTAGGGTTGAATTCCCAGCACCCACACGGATGTTCACCACTTCTTCAGACACCAGGCATTACAGGTGGTGCAAAGACATA
CATGCAGGCAAAACATACATACACACAAAATAAATTAATAATAAAAACTTTTATTAAATCAAAATAAAATGTAAAAAAGA
CTGAAACAACGCACTCACTGACATAGCACCTANATGAGTGCTGTACTATTTTGCAGGTAAGGAAATGAGGCTTAGGCAAC
ACTAANAAACCTGACAATAATATATCTATTTCACTGACTCCNATAGGTTGAAATACAGGTTACCTTCCNNTGATATCCCA
AAAGTNATAACCCTANNCNATTANNNNNATNNNAGCTCTTTTAANTTTTTACTATANNNAACTAGGNNNGGTANCTCANT
NCACACTGCTNATTGTGCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14958G5HMR1
Sequence
CNNTGAGATACACAGGCACTGTTTGTTTGTTTGTTTGTTTATTTATTTATTTAC
Sequence Type genomic DNA
Unitrap ID UNI20513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18007298..18007348 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]


Sequence tag IST14958G5HMF2
Sequence
ACAGACTTCCCAGTGTTCTGGCTCTTGCAACAGGATGGAAGTATGCAGCCAACAGAAGGGAATAGCTGAGACTATCCTTA
GAGTTAGGTAAGAACAAAAGAGTAAAGCTAATAACTGCCCATGCCTTTCTGTGAGGAGAGTTACTGAAAGGCTAGCTACA
CAAGGAACCCTGAAGCCACGAACACCAGATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 70417558..70417749 192
NO GENE  

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es