Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_277G10-3
Clone ID CMHD-GT_277G10-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_277G10-3
Sequence
CATCACCCTCACCAACACCCTGATGGTGCCTCTGAATAACTGCACCATGGTTCTGGAGGGGAGTGGCCTCATCAATGGGC
AGATGACAAAAGACCTTGGGACTCTGATGGCCGGACACACTATCCGAATTCATCTGGAGCTCTACCCCATCAAAGCTGGG
CCCCACCAGCTACAAGTCCTCATCAGCAGCAGTGAGGTCAAGGAGATCAAAGGCTACAAGGACATCTTGGTTGCTGCAGC
TCCAGCCTCCTGAGGCCTGCCTTCCTACTGCCCTTCCCAGTGTTTGTCCCAGCCTCCCTTCCCACCCCCAGCACAGCCTT
TTCACAGCTTTCGACTTCTCCAGGTGCTTGCTATCTTGTTCAACCTCTGTAGTGTGGGTAGTTGTAACTCTGTAGAACTG
CTGTGCATCATGGGAAGAAACAATAAAGATGTGTTAGCTCTCTCCTCC
Sequence Type mRNA
Unitrap ID UNI13478

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 120918975..120919832 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079103 (Tgm7) transglutaminase 7 Gene [Source:MGI (curated);Acc:Tgm7-001]

 
Come back to gene ENSMUSG00000079103


For any suggestions or comments, please send an email to unitrap@crg.es