Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14293F8
Clone ID IST14293F8
Vector VICTR74
Project tigm

Sequence tag IST14293F8HMR1
Sequence
NACCTTTTACTGTTTGCTCTGACAGANAGAGACCTAATGAATCTGGTTAGTTTCAGGGACTTCCTGAAGCTGTTTTGAGT
TGTTTTACTGTCCTGTTTAAAGAGCTTCCTTGCCAGATGGAACCGGTGGACCAGGGCCTAAGGTACTCTGTGGATCACTA
ATGAGGAATTGCCTCTGCTGGGTGACCAAATCTGAGGAACCACTCTCTACTCGGGAACTAANATGCTAANAAGACTCTGG
GCTCANCTCANGCTCTAANTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI33643

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104726980..104727243 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035642 (1810020D17Rik) NM_183251 RIKEN cDNA 1810020D17 gene Gene [Source:MGI Symbol;Acc:MGI:1913523]


Sequence tag IST14293F8BBF1
Sequence
AAGGTGATCGTCTCTCTCAAACTAAAGGAAGTTGAGCTGAAAAAAAAAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104727239..104727293 55
NO GENE  

 
Come back to gene ENSMUSG00000035642


For any suggestions or comments, please send an email to unitrap@crg.es