Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_277H06-3
Clone ID CMHD-GT_277H06-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_277H06-3
Sequence
CTCTTTGTGATCGACAATGGTGCAGATGACTGGCGGATAGCCCTGACCTACGAGCGTATCCTCTACATCAGCCTGGAGAT
GCTGGTGTGCGCCATCCACCCCATCCCTGGAGAGTACAAGTTCTTCTGGACTGCACGCCTGGCCTTCTCCTATACCCCAT
CTCGGGCAGAGGCTGACGTGGACATTATTCTGTCCATCCCCATGTTCCTGCGCCTGTACCTGATCGCCCGGGTCATGCTG
CTCCATAGCAAACTCTTCACTGATGCCTCCTCCCGAAGCATCGGGGCCCTCAACAAGATCAACTTCAACACCCGATTCGT
CATGAAGACGCTCATGACCATCTGCCCTGGCACGGTGCTGCTGGTGTTCAGCATCTCTCTGTGGATCATCGCTGCCTGGA
CTGTGCGAGTCTGTGAAAGGTACCATGATCAGCAGGATGTAACTAGTAACTTTCTGGGTGCCATGTGGCTCATCTCCATC
ACGTTCCTTTCCATTGGCTATGGGGACATGGTGCCCCACACATACTGTGGGAAAGGTGTCTGTCTTCTCACCGGCATCAT
GGGTGCAGGCTGCACTGCCCTTGTGGTAGCTGTGGTTGCCCGAAAGCTCGAACTCACCAAAGCAGAGAAGCATGTGCACA
ACTTCATGATGGACACTCAGCTCACCAAACGGATCAAGAATGCCGCCGCCAATGTCCTCCGGGAAACGTGGCTAATCTAT
AAACATACAAAGCT
Sequence Type mRNA
Unitrap ID UNI13479

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89413240..89465104 420
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000794 (Kcnn3) NM_080466 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3 Gene [Source:MGI (curated);Acc:Kcnn3-001]

 
Come back to gene ENSMUSG00000000794


For any suggestions or comments, please send an email to unitrap@crg.es