Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_286F06-3
Clone ID CMHD-GT_286F06-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_286F06-3
Sequence
TTTGATGGCATCCATGTGGTGAGTGGATCTCTTGATACATCAATCCGAGTCTGGGATGTGGAGACAGGAAATTGTATTCA
CACGCTAACAGGACACCAGTCATTAACGAGTGGAATGGAACTCAAAGACAATATTCTTGTCTCTGGGAATGCAGATTCTA
CAGTTAAGATCTGGGATATCAAAACAGGACAGTGTTTACAAACTTTGCAAGGTCCCAGCAAGCATCAGAGCGCTGTGACC
TGCTTACAGTTCAACAAGAACTTCGTAATTACCAGCTCAGACGACGGAACGGTCAAACTCTGGGACTTGAAAACGGGTGA
ATTTATCCGAAACCTCGTCACATTGGAGAGTGGGGGGAGCGGGGGAGTTGTGTGGCGGATCAGGGCCTCAAACACAAAGC
TGGTGTGTGCAGTCGGGAGTCGGAATGGAACTGAGGAAACCAAGCTCCTGGTGCTGGACTTTGATGTGGACATGAAATGA
AAAGCAGACATGATGAATTTTGTCCAACTGTGTAGACAATATACTCCCTACCCTTCCCCCTGCGC
Sequence Type mRNA
Unitrap ID UNI13482

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 84780096..84781528 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028086 (Fbxw7) NM_080428 F-box and WD-40 domain protein 7 Gene [Source:MGI (curated);Acc:Fbxw7-001]

 
Come back to gene ENSMUSG00000028086


For any suggestions or comments, please send an email to unitrap@crg.es