Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12680B4
Clone ID IST12680B4
Vector VICTR76
Project tigm

Sequence tag IST12680B4BBF2
Sequence
ATATAACTTTTAATGTTAAATACAGATGTGTAGATACATAAAAGTTTTATTCTGGCAGCCATGTTAGACAATGTCTAAAG
AGTTGTGAATGCCTGANATGTTGTCCTTCTCGCTACTGTGATAGAAAGAGCTGAGTTAGCCCTGCTACCTGTACAGTAAT
GTGGTCACTAACAGAATAAAGCTGTGAATAAAGCTGTGAGAANAGGAAGACTTTCTGGACCTGCACANAANAATGTGATG
TNNNNGTNANTATTGTCTTGTGGTCNANCNNNCTNCA
Sequence Type genomic DNA
Unitrap ID UNI33645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106897521..106897785 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]


Sequence tag IST12680B4HMF1
Sequence
CTATTANCAAATTANNNACTTGGGAATAATTTAACAATGCCNGTNCNNAATGTACNTTANNAAAACTATAANNTATANTA
NGAANTCNTTANNGGGCTANNANGGGATANAAAGATACCTCAAGTCCATGAACCNCAAGATCTAACACTGTGGTGGCAGT
GTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es