Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14457D2
Clone ID IST14457D2
Vector VICTR74
Project tigm

Sequence tag IST14457D2HMR1
Sequence
AGAAAAAGACACCCTACCCTTCCAGTCNAAGAAAGACAGCCCAAGATGAAGGAGAGGGTGTGGTCCTGCATGAAAACAGC
AATGCTTAACTCAGCACCAGGTCAGTCCTGAGTTCAAGCCTTGCTGGTTATGACCCTTATGGGAGGAACTGAAGTGGCAA
ATTAACCAGTATAATGAAGTCACTGCATTTTGTTTGCCTTTGCTGGTTTCCCCTGGAGATCTGTCCTCTGGCNNGC
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704720..55704951 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


Sequence tag IST14457D2HMF1
Sequence
TTCTCTGTCTACATAACCTTGCCTCCCTTTTCATGTAAAATGTGGAATCCCTCTCATCTCAAAGCCACTTCCTCCCTCTC
TATCTCTGTCTTCTGGCCCAGTCTTGTCTAGACCTTTTTAAAGGGAGGGTCTCAGGCTGGCCTCAAACTCCCTTTGTAGC
TGAGGATGACCTTGAACTGAGTCCTGCTTCCACCCTGCGAGTGCTGANATGACAGGCGCACATGTGCCACCNCGCCTAAC
GGCCCNNCNCCTGTCTCCCNCTCTTGTCTGCTCTGTTCNCTCTACTCNCNANTGCCNTANNTTNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704948..55705246 277
 
EST/CDNA Est Name
  CJ129471.1 - CJ129634.1 - CJ127815.1


Sequence tag IST14457D2BBF1
Sequence
TTCTCTGTCTACATAACCTTGCCTCCCTTTTCATGTAAAATGTGGAATCCCTCTCATCTCAAAGCCACTTCCTCCCTCTC
TATCTCTGTCTTCTGGCCCAGTCTTGTCTAGACCTTTTTAAAGGGAGGGTCTCAGGCTGGCCTCAAACTCCCTTTGTAGC
TGAGGATGACCTTGAACTGAGTCCTGCTTCCACCCTGCGAGTGCTGANATGACAGGCGCACATGTGCCACCACNCCTAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55704948..55705186 235
NO GENE  

 
Come back to gene CJ129471.1 - CJ129634.1 - CJ127815.1


For any suggestions or comments, please send an email to unitrap@crg.es