Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12370E9
Clone ID IST12370E9
Vector VICTR76
Project tigm

Sequence tag IST12370E9BBF1
Sequence
CCACGAAGAGGAGGACTCCCCACCATTGCCTCTGGGACCCCCAATCCCTGGTGATCCCTGGCCTGGGGCGCCTCCTTTGT
TTGATGAACCTCCGCCTCCAGGCTCCAACCGTCCCTGGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670887..35671012 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]


Sequence tag IST12370E9HMF1
Sequence
CCACGAAGAGGAGGACTCCCCACCATTGCCTCTGGGACCCCCAATCCCTGGTGATCCCTGGCCTGGGGCGCCTCCTTTGT
TTGATGAACCTCCGCCTCCAGGCTCCAACCGTCCCTGGAGAGATCTTCCTGACAGTGGTGCCTGGCCCCCAAAGCCCCCA
AGCACTGATCCCCCTAAACCTCCTCTGCCTGATGACCCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670887..35671088 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]

 
Come back to gene ENSMUSG00000024409


For any suggestions or comments, please send an email to unitrap@crg.es