Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10854G8
Clone ID IST10854G8
Vector VICTR76
Project tigm

Sequence tag IST10854G8HMF1
Sequence
GTTGAGGTTTTTATTGTAGACATGAGGGAGATACAGTCAGAGGCACCTGGAAGAGTCCAGAACAGGCAGAGAAAGTAGAC
TGAACACAGCCAGTTAAAGGANAGAGGGAAGGAGAATGAGAGGAAGAAAAAGGAGCAAAGGAGGGCAAAGGCTATTGAAA
GTGGACCCAAGAGCGCACATGGA

Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448156..100448337 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST10854G8BBF1
Sequence
GTTGAGGTTTTTATTGTAGACATGAGGGAGATACAGTCAGAGGCACCTGGAAGAGTCCAGAACAGGCAGAGAAAGTAGAC
TGAACACAGCCAGTTAAAGGAGAGAGGGAAGGAGAATGAGAGGAAGAAAAAGGAGCAAAGGAGGGCAAAGGCTATTGAAA
GTGGACCCAAGAGCGCACATGGCCAAAATGTCAGGTTTCCCCCCCTNCAGGTTTTTTGTTTTTTGTTTTTTTAATANNNA
TNANNATTTGGGAGAAGGGAAGGAAAAGACCCCAGGTGTCAGGCTGGCNNNNGAGGCTTANGGTAGGTGGTAAGGTGAGA
AGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448011..100448337 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST10854G8HMR1
Sequence
NTCNTGTCTTCCTTTGATTCGCACTCGTCTTAAATGGCATGTATCCATCAAACCTCTCCCCTCAGCGCTTAGAAAACTAT
GTAGGAAAGGCGGGATGATTCGGCAATGAATCACACCCAGAAAACAGTGTCTTCCAAACACAACAGGGCTAAAAACATAG
AAACACACAGAGACTGTGGCANCATACATAGGGCCTCCACAAGTTCAAGCCAGATGGAGTCCCAGTGCTGAGAGGGGAAA
GTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448353..100448594 238
NO GENE  

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es