Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11484B6
Clone ID IST11484B6
Vector VICTR76
Project tigm

Sequence tag IST11484B6HMF1
Sequence
AAAGAAAAATAGATCTGGTGTGATGCTGCATGCCTGTGATCTCANCACTTGGGAGGGGGGAGTCCGAGGGTCCAGAGTCC
AAGGCCAGCTGTGGCTACATGAGACTTGGTCTTAAACAAGCAAGTAAATGGAGTTTCTGCATGGA
Sequence Type genomic DNA
Unitrap ID UNI32648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 63455552..63455695 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021461 (Fancc) NM_007985 Fanconi anemia, complementation group C Gene [Source:MGI Symbol;Acc:MGI:95480]

 
Come back to gene ENSMUSG00000021461


For any suggestions or comments, please send an email to unitrap@crg.es