Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_281B06-3
Clone ID CMHD-GT_281B06-3
Vector pNMDi3
Project cmhd

Sequence tag CMHD-GT_281B06-3
Sequence
ATAACCATACAGGATGACAGTGACAGCCTGGAAAGAATTGAAAAGGAAGGCCAAGATCCATTATTGAACACTATATATGC
CAAAGACGTCTTCAATTACTTGAAAGAAAGAGAGGTCGATATATGGGTTGAAAAACCTACTGAGAGCATCTCAGAGAGGC
CTACCAACCCGGTCACTTGATGAGACCACACCTTTTCCGGGTGGGAGATGCTGTTCTCGACAGACAACATCGAGCTGAGA
ATCTAAAACCTTGTTAAAAAGGCCCTTGCATCTTGCTACTGACCACCCCCACTGCTGTCAAAGAAGAAGGCATCTCTGCT
TATATTCATGCCTTTCACGTAAAGCGAGCTCCTGAAAAATAAACCCCCTTGGTTGACCACTCTCATTTCTACTGTGATAG
ACCCTCTAATAATTTTGCTCTTCCTGCTGACGTGTGGCCCACTAATTCTTAATAATCTAATGACCTTTGTTAGAGAGAGG
ATTGGTGCTGTCCGGCTATTAGTATTAAGACAACAATACCAGTCTCTGCAGAACCTTGAAAAAGAGGTTGCAGTTTAGTT
CTAAGATTAGAACTAGTAACTAGAAGAAGTGGGGAATGAAAGATCCTGGCAGAATGTAAAAGGACACAGAAGCCCTGAAA
TTGGCAAGATAGACGTCAGTGTTAGCAGAACTAGCTTCACTGATTTAGAAAAATAGAGGTGCACAATGCTCTGGCCACTC
CTTGAACCTGTGTGT
Sequence Type mRNA
Unitrap ID UNI13493

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6575922..6582473 572
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051592 (Ccnb3) NM_183015 cyclin B3 Gene [Source:MGI (curated);Acc:Ccnb3-001]

 
Come back to gene ENSMUSG00000051592


For any suggestions or comments, please send an email to unitrap@crg.es