Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13599G1
Clone ID IST13599G1
Vector VICTR74
Project tigm

Sequence tag IST13599G1HMF1
Sequence
NTAAGTACAGTAGAAAACAAATCCATTAAAGGTGACAGAATACGGGTACATCTTGTANCACAGAGGGACCCTGAAAATGA
TACCAAGGGCANANAGTCCGTCACAATAGGCACAGATAATATGCAAATGGTAGCTGTCTGGAAGGGAGGAGAGTGGGAAA
GGAGGTGCNNATGGCTGCTGAANGGGANGAATACCTTCNGAAATGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13599G1HMR1
Sequence
CTTACGTCACATGTTTTATCTGTGTGTTCATTGATGGCTTTGAGTTGTTTGTGCCTTTGTAAAGGTGAGAACTGACTCTG
CTCTGTCCTTTACACGTGTGTGGTGTAGTTCACACTTTCCCACCACACACGCATGCGCACACACGCACAGCCTATTTTCC
ATTGGATGGCCTTAGCACCCTTGCTGAAAGCAAACAGAAATGGAGGAATATGCGGGTTTATAGCTGGGATCTTGGCTTCT
GTGTTGTTCCGTGTTTTTNANACAGTGTCAAGGCTGTCTTCANACTTAANTANAGGANGACGTCACANATGCN
Sequence Type genomic DNA
Unitrap ID UNI17399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147593454..147593765 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029640 (Usp12) NM_011669 ubiquitin specific peptidase 12 Gene [Source:MGI (curated);Acc:Usp12-001]

 
Come back to gene ENSMUSG00000029640


For any suggestions or comments, please send an email to unitrap@crg.es