Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14601D8
Clone ID IST14601D8
Vector VICTR74
Project tigm

Sequence tag IST14601D8HMF1
Sequence
TCCTTTATTTGGGTGCTGGGTGTATTANCTGTCTCTGAATAAATCCTTAATTANCTGCCCTGGCTGTATTTGCATAATGG
ATTTCACTTTGTTCTTAAGTTAATGGTGTTTTTGTAACAGAACAGTAACCTCTTGGTTCACGGCCATTAAAATAACTGCC
ACCCTGTGGGGCAGAGCCAGGGTTATGTAAAGGAGGTTCAGTTAAGAGTTCAGAGGAGTAAAAGGGGGTGCAGGAGTAGT
TTCTGGTTCCTCCCTGANAGTGTCAGAAAGGCCNCTGTCNGANGAACCCTAAGGTTTGAAGCTGCTTCAGGGTCACTTCC
TGGCAAGTAGTCTGNCNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77704442..77704775 322
 
EST/CDNA Est Name
  BQ956130.1 - CF895427.1 - CB952910.1 - CB953491.1 - AA242349.1 - AW226904.1 - AI663541.1 - BG062927.2 - BB846632.1 - BB845748.1 - CA479862.1 - BB847443.1 - BB848078.1 - BB845045.1 - CB951290.1 - BY006260.1 - AW107072.1 - BY089123.1 - AA589823.1 - BY096867


Sequence tag IST14601D8HMR1
Sequence
NAAGGAGAATGTCTTTCTGAGGAGTGGCCTGGCAAAAGGGACCCTTCTCTGGCTGCTGGCTGTGAGTACTACTGANCTCT
ATTAGGTAGGAGATGAGCTGAGCCTTGAAGGGCAGAAGTCTGCCCAGCAAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77704313..77704446 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es