Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12444H7
Clone ID IST12444H7
Vector VICTR76
Project tigm

Sequence tag IST12444H7BBF1
Sequence
AGTGGGTAAGAGCACCCGACTGCTCTTCCAAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCC
GTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI451 UNI4207 UNI33656 UNI33657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5821187..5821279 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 49867364..49867456 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56991004..56991096 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 52180660..52180752 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022637 (Cblb) NM_001033238 Casitas B-lineage lymphoma b Gene [Source:MGI Symbol;Acc:MGI:2146430]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12119350..12119442 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12166380..12166472 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 80087943..80088035 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106315292..106315384 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4512783..4512875 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20632958..20633050 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4722142..4722234 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 83388143..83388235 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031714 (Gab1) NM_021356 growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 83076757..83076849 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 80694122..80694214 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 88851346..88851438 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148774772..148774864 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028960 (Ube4b) NM_022022 ubiquitination factor E4B, UFD2 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ube4b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 29665741..29665833 93
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 19979492..19979584 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060090 (Rp2h) NM_133669 retinitis pigmentosa 2 homolog (human) Gene [Source:MGI (curated);Acc:Rp2h-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 12001999..12002091 93
NO GENE  

 
Come back to gene ENSMUSG00000060090


For any suggestions or comments, please send an email to unitrap@crg.es