Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_276F12-3
Clone ID CMHD-GT_276F12-3
Vector pMS3
Project cmhd

Sequence tag CMHD-GT_276F12-3
Sequence
CTGCTCTAGGTGCCGTATATGAATCAAAGGACAGGACTTGCACGATCTACTAGGGTGGTTGCCCCTTTCCATAACGGCGT
TCCGTACCGTCTGGTATTTGCAGTGAAGGTGGAATAGTGTCTGGCTACCGTACTCCCTGTCCCTAGGCCTTCCCCAGAAA
GCCTTTACGTTCGCACAATGAGGTATCCCCCCCCCCCCTCTCCTGCTGTTGCCCTGGCTCATGCTACTCACAGGCAAAGT
GTCTCTGGCCCAGTTTGCCCTGGCCTTTGTGGTGGACACGTGTGTGGCAGGTGCACTGTTGTGTGGTGCTGGGCTGCTTT
TCCATGGCATGCTGCTGCTTCTGGGACAGACCACCTGGGAGTGGGCTCGGGGTCACCACTGCTATGACCTGGGCACCTGC
CACAACCTGCAAGCAGCCCTGGGGCCTCTCTGGCCCCTAGTCTGGTTCTGGCCTTTTCTAGCCTCTCCTTTGCCTGGATA
TGGGATCTCTTTCCAGACTCCAGGTGATGTGGGTCTTGTAACTTCC
Sequence Type mRNA
Unitrap ID UNI13494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4880282..4883768 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006463 (Zdhhc24) NP_081752 zinc finger, DHHC domain containing 24 Gene [Source:MGI Symbol;Acc:MGI:1917855]

 
Come back to gene ENSMUSG00000006463


For any suggestions or comments, please send an email to unitrap@crg.es