Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10239F2
Clone ID IST10239F2
Vector VICTR76
Project tigm

Sequence tag IST10239F2HMF1
Sequence
ATAGTTTGCTGTNNAAACAAGGGAGGAAGAAAGTCAGCATTCCCCACCCATGGAGTTCATCTCAACAGTGTTTTCCCAGT
TGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20432018..20432104 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


Sequence tag IST10239F2BBF1
Sequence
ATAGTTTGCTGTCAAAACAAGGGAGGAAGAAAGTCAGCATTCCCCACCCATGGAGTTCATCTCAACAGTGTTTTCCCAGT
TGTTAACTATCCATCCCTCCTGACTTANACATGACACACACCCTCAGAATGAGGATGCTACATGCTTATCCGACAGGATG
CCTCCTTTCACATACTTTTGTTGACTGGTTTGTTCACTTTGTCTTGTTTTTTAAATATTTTCTTCATCTCTCCTCCCATT
GAGGGCCGACTAGGCCATCCTCTGCTACATATGCAACTANAGACACAAGCTTTGGGGGGTACTGGTTAGTTCATATTATT
GCTCCTCCTATAGGGTTGTAGACCCCTTTANCTCCTGGGGTACTTTCTCTAGCTCCTTCATTGGGGGCCCTGTGTTCCAT
CNNATAGATTCTAGGCTGTGAACATCCACTTCTGTATTTGACAAGCACTGGCNAGCCTCACAAGANACAGCTATATCAGG
GTCCTGTTANCAAAATCTTGCTGGCCTATGCNATACTGTCTGGGTN
Sequence Type genomic DNA
Unitrap ID UNI32282

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20432018..20432542 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es