Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10579H8
Clone ID IST10579H8
Vector VICTR76
Project tigm

Sequence tag IST10579H8BBF1
Sequence
NCGCCACCATGCCCGGCTCACTCCTGCTTTTTGAGGCAGGTTCTCACAATATATCCTATATCAGCTTTGGACTTACTGTG
TAGCCCATGCTGACTGTCAACTTGTGCCTATCTGGCTCACAAATATGANCCACTTTTTAAATATATATTTATGATTTTAT
AAGTCAGGCAGTGGTAGCACACACCTTTAATCCCAGCACTCAGGAGGCAGAGGCAGGTGGACTTCTGTGAGTTTGANACC
NNCCTGGGCTAN
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7739512..7739761 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]


Sequence tag IST10579H8HMF1
Sequence
GCGCCACCATGCCCGGCTCACTCCTGCTTTTTGAGGCAGGTTCTCACAATATATCCTATATCAGCTTTGGACTTACTGTG
TAGCCCATGCTGACTGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI19866

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7739662..7739762 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039201 (Tbc1d25) NM_172478 TBC1 domain family, member 25 Gene [Source:MGI (curated);Acc:Tbc1d25-001]

 
Come back to gene ENSMUSG00000039201


For any suggestions or comments, please send an email to unitrap@crg.es