Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10891E7
Clone ID IST10891E7
Vector VICTR76
Project tigm

Sequence tag IST10891E7HMR1
Sequence
GGTACATCNNAGGAGTGGGCGAGGGCTGGGATGCGGAATGGCAGATGCGTANACAATTTCGAGTTACTCAGAATCTTTAT
CCACAATCCGTGATGCAAAGTTTAAAAATAATACCCTTGTTTACTACTTTGTTTAGTAAATAGATTTTACTAAAAAACAT
TCAGGGAGGCAAAACCTTTAAAAAAAAATCGGGAAGTTGAAAATTACTTCTTCCCTCTGGCCTGTANAGGTCGCCCTATG
CCTGTCTCCAACAAAATGACCGACCAAGGATGATCTTTGCTTACTCACCANAGTAGGAGGATCTACCAAANGGGGAAAAC
TNNTAATGAGGAN
Sequence Type genomic DNA
Unitrap ID UNI3041

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62094267..62094598 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014243 (2410012H22Rik) zinc finger, SWIM-type containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916997]

 
Come back to gene ENSMUSG00000014243


For any suggestions or comments, please send an email to unitrap@crg.es