Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10006B3
Clone ID IST10006B3
Vector VICTR76
Project tigm

Sequence tag IST10006B3BBF1
Sequence
GATGCTCCCTTGCCGCAGAGCCTCTGTGCTCCTCCCACACCCACCTGTATCTTTGCTTCCATTCC
Sequence Type genomic DNA
Unitrap ID UNI33660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63969567..63969630 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032401 (Lctl) NM_145835 lactase-like Gene [Source:MGI (curated);Acc:Lctl-001]


Sequence tag IST10006B3HMF2
Sequence
CCAGCAGGCTCTGCTGCGGCGGGTGTGCGGACCTGACCCTCCCCCACAGCAGCCACTCACAGTCATCCCCCTGCCTCAGA
CAGTCACTTAGCGTCATTCCCCTGCCTCAGAAATTCACTCACAGTCATCCCCCTGCCTCACAAATTCACTCACAGTCATC
CCCCTGCCTCAGAAATTCACTCACACTCATCCCCCTGCCTCACACCCACAATCAGTGCCATCCACCTGCCTCACACACTC
ACTCACGGTCATCCCCCTGCCTCACAGTCACTCAACGTCATAGCCCTACATCACACAGTCACTCAGCTTCCTACCCCTGC
CTCACACATTCAATCCAGGTCATCCCCCTGCCCCACATATTCACTCGCAGTCCCAGCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166436463..166436834 362
NO GENE  

 
Come back to gene ENSMUSG00000032401


For any suggestions or comments, please send an email to unitrap@crg.es