Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10124G5
Clone ID IST10124G5
Vector VICTR76
Project tigm

Sequence tag IST10124G5BBF1
Sequence
TACAGAAGATGTCGCCCACTTCCCCATATGCTCCAATCAGTCTTTGAAGTTTCATTATGTGAATATTTGCTAATCAAACA
ATACACACAGGTACATCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACA
CACAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81899892..81900055 162
NO GENE  


Sequence tag IST10124G5BBR1
Sequence
TGTAACCCTGGCTGCTGTTCACTGTTGGCAGACTCACAAATCGTCCGCTCTCTGTTGCCCACTTGCTCTGCTCAGTGTTC
TCTAAGCAGGGTTTCTGAGCAGAGGTTCAGGGCTGATAACAGTCGACACTGTGGATGTGTGCGTTGCTGTTTTCCAGTGA
TAAGTAATTCTATGATGAGTATCTTGGTGTGAATTACTTTCCCCCTTTTCAGTTTAGAATATTCTTTCTCTACAGTTAAG
TCTAAGCTTGTGATGAGA
Sequence Type genomic DNA
Unitrap ID UNI30573

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81899638..81899895 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031681 (Smad1) NM_008539 MAD homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Smad1-001]

 
Come back to gene ENSMUSG00000031681


For any suggestions or comments, please send an email to unitrap@crg.es