Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10735B2
Clone ID IST10735B2
Vector VICTR76
Project tigm

Sequence tag IST10735B2HMF1
Sequence
CCCTATCTCTGCTTTCTGAGGTGGGAATTGCAGGAAGGA

Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101969301..101969338 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]


Sequence tag IST10735B2BBF1
Sequence
CCCTATCTCTGCTTTCTGAGGTGGGAATTGCAGGAAGGCCACATGTTCACCTGGCGCTTTCTTAGGTTCTGGGATCT

Sequence Type genomic DNA
Unitrap ID UNI29572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 101969263..101969338 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048058 (Ldlrad3) NM_178886 low density lipoprotein receptor class A domain containing 3 Gene [Source:MGI (curated);Acc:Ldlrad3-001]

 
Come back to gene ENSMUSG00000048058


For any suggestions or comments, please send an email to unitrap@crg.es