Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168A5
Clone ID IST14168A5
Vector VICTR74
Project tigm

Sequence tag IST14168A5HMR1
Sequence
GAATGTAAAGGGTTCTGAAGTAAAGCAACACTGTAATTCCNGTATTGAGGCCGAGAGACAGAAGTGATTGCAGTTCAAGG
CTAGGCTAGCCTGTTGTGATGGCGTACAGTCTGTCGCAGGAGTGAGGGGCGTAAATACTGTCTTGTTTGGTCAGTCAGCT
TTTATTCATACANAAACTTCTGACTTTTTTGCAAAGTTGAAATCTGGAGAAATCCAACCACCNNGGACGCTTTACAAAGG
AACATTANGCATACNNACTTCTGTGANCGTTTTTGTGTGTTTATAGCCTATN
Sequence Type genomic DNA
Unitrap ID UNI18241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 139995569..139995859 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045624 (Esf1) NM_001081090 ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Esf1-001]

 
Come back to gene ENSMUSG00000045624


For any suggestions or comments, please send an email to unitrap@crg.es