Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0233
Clone ID GC0233
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0233
Sequence
CTGGGACAAGCTATCTATCATGGGCGTTGATGTGCAAGGCCGCTGCACTTTTGAGTACAGAGGAATGAACTTCATCAGGT
GATACATCGGAGGGCAAGCCACCAATGCCTGCAGGGTGNNATTNATGTANNANCAGTNNCCNTTATTGATCANCCCACGG
GGTTGCAATGACACTGGCTTA
Sequence Type mRNA
Unitrap ID UNI203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122471003..122471712 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031826 (Usp10) NM_009462 ubiquitin specific peptidase 10 Gene [Source:MGI Symbol;Acc:MGI:894652]

 
Come back to gene ENSMUSG00000031826


For any suggestions or comments, please send an email to unitrap@crg.es