Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10420E1
Clone ID IST10420E1
Vector VICTR76
Project tigm

Sequence tag IST10420E1BBF1
Sequence
CACTGGCCCTAATGCCAGCATCTGCAGTCAGATCAATGGATATGCCAGGCTGTGTGGTGGGAGGCACGTGCTGAGCAGTC
AAAAATAATTGCTGCCAAGGCCTTGATCCGGAGGAGACACAGGGCATTAGGAACGTCACAGGCAGATAGGAGGATATTTC
ANGCCCAAAGAGAGCTGAAACCNACCCCTCAGGTTTGTGAAGCCTTGCCTGCTCTGACAATCTNNNGTAGGTAGGTGGTA
AGGAATGAANGNTGCCNNNTTTGTAGTTTGAATTTTCTTGTTCCTCCTTTGCAAGATGTCTGCGCCTAGGGGAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38527142..38527460 299
NO GENE  


Sequence tag IST10420E1HMF2
Sequence
ATAGCATTATTCACAATTACTACTAAGTAGAAATAATGCGCATCCACCAACAGATTAAGTACAATAAATGCATACATTGG
AATATTATCAGTAAAGAGAAGAAAGTTCTGCAGAAGTGCTGTAATATGGGCAAATCATCAACGTAACTGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27172430..27172585 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es