Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15001D10
Clone ID IST15001D10
Vector VICTR78
Project tigm

Sequence tag IST15001D10HMR1
Sequence
NCTAAATTGTGAAGAGTCCTAGGTTGAATCCCTTTCACTAAAATGAATGAAGGGACCAAAGTGCTGTGAAATACAAGATT
GTTTAATAACTATTTCACAAAACAGTTTTGTTTTGAGGAGAAAAAACTTTAATTGAAAGAAAATCAACTGAAAATCTTTC
CCCCACCCCCACCCCTTATTTTTCAGGGTGCAAGATGACCAACGAAGAACCTCTTCCTAAAAAGGTATGTCNNCANCTTC
AAACCCTCCTTTCTTANAGTTTAAGGGGCNATTCTATGTCCTTATTTTCCACTTCCTTTACCTTGTACTTTGCATCAAGG
GACTACAGCTTTAANATGTCTCTGTATGTGCTCAGTTTCACAGCTTTTANAAGGCATTACAGTATTCCTGTGATCNTCNC
TTCTTANCCTGTATTACATTACCATATACACACGTGAACAATTTCTGAATATTTTACAGATTTTACACNCNTCTATNCNC
NCNCATGTATGTNTATGTTCCTATTTNNGCN
Sequence Type genomic DNA
Unitrap ID UNI12184

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13178500..13179004 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060475 (Wtap) NP_001107005 Wilms' tumour 1-associating protein Gene [Source:MGI Symbol;Acc:MGI:1926395]


Sequence tag IST15001D10BBF1
Sequence
AGGTTAGTTAGCCCAGGATAGCTTCAATTAACAACCACCAAAAAAAGGGCACAAAAGACATAAGTACCCCCGTAACTTTC
ACCAAATTTCCTCTTTGCTAACATCTTTCATCATCGTGGTTATATTATTTTTAAAAAAGTGTAAGTCAGGCCTCAGAAGG
CCACCGAGGCCTGTTGCTAAAGGCCTAGAAGGGCAGCACCGGCCACCAGTTTGCTGGCCTTGACTTGTACAGCATTGCTG
TGACAGTAAAGCAAAAGCCATCATGTGATTCACTACACTCTAACGATGTTAAATATAAAGTATATNTACCTTAAANACNN
AACCATGTAACAAATGGACCTNANNCNANGCANTANNNANGTTGGGAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000060475


For any suggestions or comments, please send an email to unitrap@crg.es