Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10725E1
Clone ID IST10725E1
Vector VICTR76
Project tigm

Sequence tag IST10725E1HMF2
Sequence
CAGAACAGGCAGAGAAAGTANACTGAACACAGCCAGTTAAAGGANANAGGGAAGGANAATGANNAGGAANAAAAAGGAGC
AAAGGAGGGCAAAGGCTATTGAAAGTGGACCCAAGAGCGCACATGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10725E1BBF1
Sequence
CAGAACAGGCAGAGAAAGTAGACTGAACACAGCCAGTTAAAGGAGAGAGGGAAGGANAATGAGAGGAAGAAAAAGGAGCA
AAGGAGGGCAAAGGCTATTGAAAGTGGACCCAAGAGCGCACATGGCCAAAATGTCAGGTTTCCCCCCCTCCAGGTTTTTT
GTTTTTTGTTTTTTTAATAGAAATTANAATTTGGGAGAAGGGAAGGAAAAGACCCCAGGTGTCAGGCTGGCNNGAGAGGC
TTANGGTANGTGGTNNNGTGANAAGATCTGTC

Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448011..100448280 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST10725E1HMR1
Sequence
TCTGGACTCTTCCNGGTGCCTCTGACTGTATCTCCCTCATGTCTACAATAAAAACCTCAACCTTACCTTGGAGTGGTCAT
GTCTTCCTTTGATTCGCACTCGTCTTAAATGGCATGTATCCATCAAACCTCTCCCCTCAGCGCTTANAAAACTATGTAGG
AAAGGCGGGATGATTCGGCAATGAATCACACCCAGAAAACAGTGTCTTCCAAACACAACAGGGCTAAAAACATAGAAACA
CACAGAGACTGTGGCAGCATACATAGGGCCTCCACAAGTTCAAGCCAGATGGAGTCCCAGTGCTGANAGGGGAAAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100448277..100448594 312
NO GENE  

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es