Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0293
Clone ID AM0293
Vector pGT0lxr
Project sanger

Sequence tag AM0293
Sequence
GATCCCTGACCAGATCACAACCGACGTCAACCCCGAGTGTCTGGTGTCCCCGCGGTACCTGAAGAAGTATAAGAGCAAAC
AG
Sequence Type mRNA
Unitrap ID UNI2059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 46084399..46084480 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037712 (Plekhc1) NM_146054 fermitin family homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Plekhc1-001]

 
Come back to gene ENSMUSG00000037712


For any suggestions or comments, please send an email to unitrap@crg.es