Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14383E7
Clone ID IST14383E7
Vector VICTR74
Project tigm

Sequence tag IST14383E7HMR1
Sequence
NATACAAAATGCGTTTTAACTCGGTGCTCATAAAAGGTACTTGTTAGGTTCGGTATTAGCAGTTTGTAATAATCTTTGGA
TTATTGTTGCAAATGTGTGTATATTTACATACTGTGTTTTACAGAGTAGGCATTTTAAGGTTTGANACAC
Sequence Type genomic DNA
Unitrap ID UNI16106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73541109..73541257 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]


Sequence tag IST14383E7HMF1
Sequence
CTGATTTTATCTTACCTGACTGTAATGCTGTAATTCAGGGAACCTCTGGAGCCACCCTAGAATGTTACTTAACAAGAAGA
GAGAAAAAAGGGCTTCTTAGCAACCCTTTGAGATGTAACCTGAGACCACCAGAATGATATGCATACAGCTTATACACTTA
AGCCGTGCTTTTCTTTGAGAAGCCCATACCCACGCTCTCCTCTATGCTTTATTCTCTCTTCTTTATTTCTTTCTCTCCCA
AGACAGGGTTTCTCTGTGTAGCCTTGGCTTTCCTGGAACTCGATTTGTAGACCAGGCTGGCCTTGAACTCGTAAGAGATC
TGCCTGTCTCTGCCTCCCAAGTNCTGGGATCAAGTGGGTGTGAGCTACCGCTCCNTGGCNTCNTGTTTCTANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72507043..72507433 383
NO GENE  

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es