Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14256F2
Clone ID IST14256F2
Vector VICTR74
Project tigm

Sequence tag IST14256F2HMR1
Sequence
TTTACTGTTACAATTTTTACAGCTACAACAGCTGTAACTGCTAGAGGAGACAAAAAATGTAGTTCACCTTGAAAATAATC
ATGGCTCANGGAANAAAGAAATTGGGTCAAGCTTAAAATAGATGCAGGTGCANTGGCAAAAACTTTTAATAAAAAATTTA
AAATATTCCTANCACTGGATTCAANCTCCTTTTGTTCTCTGGTGGTGATGCATTGTTAGAGTGAGGCTGANCTGGTGCTT
CCCACATT
Sequence Type genomic DNA
Unitrap ID UNI24250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 44686980..44687227 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036890 (Gtdc1) NP_766250 glycosyltransferase-like domain containing 1 Gene [Source:MGI (curated);Acc:Gtdc1-001]

 
Come back to gene ENSMUSG00000036890


For any suggestions or comments, please send an email to unitrap@crg.es