Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_302C7-3
Clone ID CMHD-GT_302C7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_302C7-3
Sequence
TGTGATGGGATCACTATTATGTCTACGGAGAGCGGCCCAGGAACAAGATTGAGAAATCTGCCAGTAATGGGGGATGGACT
AGAAACCTCCCAAATGTCTACAACGCAGGCCCAGGCCCAACCCCAGCCAGCAAATGCAGCCAGCACCAATCCTCCACCCC
CAGAGACCTCCAACCCTAACAAGCCCAAAAAAAAAAAAAAAAAAAAAAAAAAATCTGCTCAGAGTGGTGCTCAAAAAAAA
AAGGAAACACCAGTTTGCGTGGCCTTTCCAGCAGCCCGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATTA
TTAAAACACCCATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAG
GACTTCAACACTATGTTTACAAATTGTTACATCTATAACAAGCCTGGAGATGACATCGTCTTAATGGCAGAAGCTCTGGA
GAAGCTCTTCTTGC
Sequence Type mRNA
Unitrap ID UNI13518

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32361116..32366664 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es